[ad_1]
Abstract
Vertebrates have a large array of epithelial appendages, including scales, feathers, and hair. The developmental patterning of these various structures can be theoretically explained by Alan Turing's reaction-diffusion system. However, the role of this system in epithelial appendage patterning of early diverging lineages (compared to tetrapods), such as the cartilaginous fishes, is poorly understood. We investigate patterning of the unique tooth-like skin denticles of sharks, which is closely related to their hydrodynamic and protective functions. Turing-like mechanism can be used to explain and test this system by using gene expression analysis and gene pathway inhibition experiments. This mechanism bears remarkable similarity to avian feather patterning, providing deep homology of the system. We propose that a range of vertebrate appendages, from shark denticles to avian feathers and mammalian hair, use this ancient and conserved system, with slight genetic modulation accounting for broad variations in patterning.
INTRODUCTION
Vertebrates have a plethora of various epithelial appendages, including hair, feathers, scales, spines, and teeth (1). These two structures share extensive developmental homology, as they grow from a common foundation: the epithelial placode (2–4). Despite this shared ancestry, there are broad variations in both the final morphology and the spatial arrangement of these organs (1). Such variation in patterning has evolved to facilitate several functions, for example, drag reduction, thermoregulation, and communication (5–7).
Alan Turing's reaction-diffusion (RD) model provides an explanation for the diversity of patterning observed in nature (8–12). This model describes how interactions between morphogens diffuse differentially through a tissue can give rise to autonomous patterning of epithelial appendages (8, 13). These morphogens typically constitute two interactive molecular signals that occupy the role of a short-range activator and long-range inhibitor (14). The autocatalytic activator promotes its own expression and expression of the inhibitor, which, in turn, represses the activator. Turing demonstrated that when appropriately tuned, the nonlinear reaction kinetics and difference in diffusion coefficients can result in the formation of a stable periodic pattern in a field of homogenous signal, in which peaks of activator alternate with the inhibitor (15). This self-organizing system defines the spatial distribution of placodes and therefore the patterning of epithelial appendages. It is worth noting that in addition to RD, other factors such as mechanosensation of the tissue may be important for controlling skin appendage patterning (16). In this case, the patterning may still be via Turing instability, but using mechanical in addition to molecular RD interactions (17). We refer to this as a Turing-like system.
There is a growing body of RD modeling throughout epithelial appendage development. This includes the role of RD in both patterning and morphogenesis of feathers and hair (18–21). These studies have revealed that fibroblast growth factors (FGFs) and sonic hedgehog (Shh) can play self-catalytic activatory roles, while bone morphogenetic proteins (BMPs) can act as inhibitors (18, 22). Despite the fact that it is a type of organization (i.e., mouse and chick), this understanding of this system is divergent lineages is limited.
Chondrichthyans (cartilaginous fishes) occupy the sister lineage to osteichthyans (bony vertebrates) and constitute an earlier diverging lineage with respect to tetrapods. The elasmobranchs (sharks, skates, and rays) are a subclass of Chondrichthyes, which have hard, mineralized epithelial appendages known as odontodes. Odontodes include teeth and dermal denticles, which consist of a pulp cavity encased within layers of dentine and enameloid (23). It is thought that odontogenic competence originated in the dermal skeleton, giving rise to denticles as a precursor to the oral dentition of vertebrates (24–26). These structures have been observed in early life as long as 450 million years ago (27, 28). Denticles have evolved to a variety of functions, including the provision of5, 29). It has been suggested that shark denticles do not follow a strict spatial pattern (30, 31), where they are subject to intraspecific and interspecific variation in morphology and patterning,32, 33). Cretaceous shark (in recent years)Tribodus limae) (34). However, experimental evidence of initiation of patterning and its genetic basis is required to ascertain the role of this system in elasmobranchs.
Reif's inhibitory field concept is considered to be the leading hypothesis for explaining odontode patterning (35). This method can be used to prevent placenta formation from within the perimeter of inhibition of areas surrounding existing teeth or denticles (35, 36). However, no underlying molecular basis has been identified to support this idea. In fact, it has been described as a verbal description of a restricted parameterization of an RD system (34).
There is thought to be early morphogenetic similarity between shark and chimeric feather patterning, the latter of which is controlled by RD (18, 37). Chick feathers initially develop sequentially in a dorsal longitudinal row along the embryo's midline. This initiator row triggers subsequent placode formation in adjacent parallel rows until the integument is covered (38–40). This is consistent with an RD system (8, 18). Embryonic sharks develop two dorsolateral rows of enlarged denticles that emerge before the subsequent eruption of intricately patterned denticles (Fig. 1) (36, 41, 42). Soon after hatching, these rows are subsumed into general scalation (26). As observed during feather patterning (18, 39dorsal shark denticles may act as initiator rows that trigger the emergence of surrounding body denticles, following a conserved Turing-like system.
(AT) Catsharks display two rows of dorsal denticle placodes (DP) and developmental stage 32 (~ 80 dpf). (B to E and G to JThese placodes undergo morphogenesis and mineralize to become dorsal denticles (DD). (C, D, F, and G to J) Their emergence precedes the subsequent eruption of parallel, adjacent rows of denticles (BD). Dorsal denticles also begin to mineralize before body denticle development (I). Dorsal denticles are longer and wider than denticles (E, F, and J). RD modeling suggests that diffusion and interaction of an activator and inhibitor from an initiator row of dorsal denticles (K) can explain the patterning of surrounding body denticles (The and M). (A) to (C) are computed tomography (CT) scans, (D) to (F) are scanning electron microscopy (SEM) images, and (G) to (J) show alizarin red-stained samples. See Materials and Methods for RD Modeling. Scale bars, 250 μm (D), 200 μm (E), 100 μm (F), 10 mm (G), and 400 μm (H to J).
"data-icon-position =" "data-hide-link-title =" 0 ">
(AT) Catsharks display two rows of dorsal denticle placodes (DP) and developmental stage 32 (~ 80 dpf). (B to E and G to JThese placodes undergo morphogenesis and mineralize to become dorsal denticles (DD). (C, D, F, and G to J) Their emergence precedes the subsequent eruption of parallel, adjacent rows of denticles (BD). Dorsal denticles also begin to mineralize before body denticle development (I). Dorsal denticles are longer and wider than denticles (E, F, and J). RD modeling suggests that diffusion and interaction of an activator and inhibitor from an initiator row of dorsal denticles (K) can explain the patterning of surrounding body denticles (The and M). (A) to (C) are computed tomography (CT) scans, (D) to (F) are scanning electron microscopy (SEM) images, and (G) to (J) show alizarin red-stained samples. See Materials and Methods for RD Modeling. Scale bars, 250 μm (D), 200 μm (E), 100 μm (F), 10 mm (G), and 400 μm (H to J).
This study investigates epithelial appendage patterning in an early diverging lineage, with respect to tetrapods, using the small-spotted catshark (Scyliorhinus canicula). Using a combination of RD modeling and gene expression analysis, we investigate the mechanism and the underlying molecular basis of shark denticle patterning. We then use small-molecule gene pathway inhibition experiments to reveal functional conservation of these genes. Last, we use Turing-like patterning system. Rather than following a random distribution (30), we find that shark denticle development is underpinned by a precise patterning mechanism that begins early in development. This conserved system may underlie the development of a wide range of epithelial appendages, thus facilitating the evolution of various functional traits observed throughout vertebrates.
RESULTS
RD simulation and gene expression analyzes suggest that a Turing-like system underlies shark body denticle patterning
We first investigated the morphogenetic patterning of shark denticles. Two rows of dorsal denticle placodes are visible at stage 32 of development [~80 days postfertilization (dpf)] (Fig. 1A) (42), preceding the emergence of denticles (Fig. 1, C, D, and F). Compared to body denticles, dorsal denticles are larger and broader and do not have distinct ridges associated with hydrodynamic drag reduction (Fig. 1, D to F) (5). An example of a dentine denture can be used to determine dentine dentistry. Patterns were generated from a row of dorsal dorsal dentin initiators (Fig. 1K), from which waves of activatory and inhibitory morphogens were radiated according to predefined values (Fig. 1L and Table S1, see Materials and Methods for further details). Spots formed in rows adjacent and parallel to the initiator row. On reaching a steady state, initiator spots of greater shape than newly formed spots (Fig. 1M), reflecting squamation of the shark (Fig. 1, D to J). This model provides a Turing-like system for controlling denticle patterning in sharks.
To compare the pattern of shark denticles and chick feathers, we examined the expression of β-catenin (β-cat), an early regulator of chick epithelial placode signaling (Fig. 2 and Fig. S1) (43). The chicken embryo expresses a dorsolateral stripe of β-cat at embryonic day 6 (E6) (Fig. 2, C and D). This stripe becomes compartmentalized into individual feather placodes at E7 (Fig. 2, G and H), which trigger the emergence of adjacent, parallel placode rows (Fig. 2, K and L) (18). The shark lateral line expresses β-cat at stage 31 (~ 70 dpf), shortly before denticle patterning begins (Fig. 2, A and B). A continuous stripe of expression was observed in the shark; however, two dorsolateral rows of denticle placodes appeared simultaneously at stage 32 (~ 80 dpf), expressing β-cat (Fig. 2, E and F). These rows become parallel to the lateral line (Fig. 2, A to F). The smaller body denticle placodes 32 (~ 100 dpf) (Fig. 2, I and J). Dorsal dorsal shark may be acting as initiation lines, triggering the emergence of surrounding units in a Turing-like mechanism comparable to feather patterning. Having noted this similarity between shark and chick epithelial appendage patterning, we have discussed the expression of genes underlying a putative Turing-like patterning system in the shark.
Whole-mount ISH for β-cat epithelial appendage patterning of shark denticlesAT, B, E, F, I, and J) and chick feathers (C, D, G, H, K, and The). At E6, the chick displays a continuous stripe of β-cat expression (C and D), which then becomes compartmentalized into feather placodes (G and H). This initiator row triggers the emergence of surrounding feather placodes, following an RD system (17). (A and B) At stage 31 (~ 70 dpf), shark denticle placodes are not visible, although patterning of the lateral line is demarked by β-cat. (E and F) By stage 32 (~ 80 dpf), two dorsolateral rows of denticle placodes are visible. (I and J) Later in stage 32 (~ 100 dpf), surrounding rows of dentine body placodes also express β-cat. The shark dorsal denticle may be triggering body denticle emergence following a Turing-like system comparable to feather patterning. LL, lateral line; BP, body placode; P, placode. Scale bars, 2000 μm (A, E, and I), 1000 μm (B, C, G, J, and K), 500 μm (D, F, and H), and 750 μm (L).
Whole-mount ISH for β-cat epithelial appendage patterning of shark denticlesAT, B, E, F, I, and J) and chick feathers (C, D, G, H, K, and The). At E6, the chick displays a continuous stripe of β-cat expression (C and D), which then becomes compartmentalized into feather placodes (G and H). This initiator row triggers the emergence of surrounding feather placodes, following an RD system (17). (A and B) At stage 31 (~ 70 dpf), shark denticle placodes are not visible, although patterning of the lateral line is demarked by β-cat. (E and F) By stage 32 (~ 80 dpf), two dorsolateral rows of denticle placodes are visible. (I and J) Later in stage 32 (~ 100 dpf), surrounding rows of dentine body placodes also express β-cat. The shark dorsal denticle may be triggering body denticle emergence following a Turing-like system comparable to feather patterning. LL, lateral line; BP, body placode; P, placode. Scale bars, 2000 μm (A, E, and I), 1000 μm (B, C, G, J, and K), 500 μm (D, F, and H), and 750 μm (L).
Using in situ hybridization (ISH), we sought to identify the potential activators and inhibitors of this Turing-like patterning system. As a result of their importance during feather patterning (18), and their expression was analyzed throughout the shark (Fig. 3 and Fig. S1). At stage 31 (~ 70 dpf), dorsal denticle placodes were not detected (Fig. S2), although β-cat expression labeled development of the lateral line sensory system (Fig. 2, A and B). By early stage 32 (~ 80 dpf), two dorsolateral rows of denticle placodes were visible, expressing the known activators of feather patterning, FGF4 and shh, more the inhibitor bmp4 (Fig. 3, A to C) (18, 42). Similar to feather patterning, bmp4 was expressed in placards rather than the interplacode regions, suggesting that its inhibitory action is indirect (18). The mesenchymal marker of feather bud development, FGF3was also expressed in dorsal denticle rows (Fig. 3D) (44), along with the runt domain transcription factor runx2 (Fig. 3E), which is associated with FGF signaling throughout mammalian tooth morphogenesis and mineralization of other vertebrate skeletal elements (Fig.45–47). An anterior to posterior dorsal denture development was noted.
The expression of genes thought to control RD patterning of chick feathers was charted during shark denticle patterning (17). (AT to CAt stage 32 (~ 80 dpf), shark dorsal denticle express placodes FGF4 and shh, which are considered activators of feather patterning, and bmp4, which is considered an inhibitor (17). (D and E) Dorsal rows also express FGF3, a dermal marker of feather bud development, and runx2, which is associated with FGF signaling during mammalian tooth development (44, 45). (F to O) Later in stage 32 (~ 100 dpf), these genes are expressed during patterning of adjacent, parallel rows of body denticle placodes. (P to R and T) ISH section of the body denticles revealed epithelial expression of shh and mesenchymal expression of FGF4, bmp4, and runx2. (S) Expression of FGF3 was observed in the epithelium and mesenchyme. White dashed lines separate columnar cells of the basal epithelium and the underlying mesenchyme. Scale bars, 500 μm (A to E), 2000 μm (F to J), 1000 μm (K to O), and 50 μm (P to T).
The expression of genes thought to control RD patterning of chick feathers was charted during shark denticle patterning (17). (AT to CAt stage 32 (~ 80 dpf), shark dorsal denticle express placodes FGF4 and shh, which are considered activators of feather patterning, and bmp4, which is considered an inhibitor (17). (D and E) Dorsal rows also express FGF3, a dermal marker of feather bud development, and runx2, which is associated with FGF signaling during mammalian tooth development (44, 45). (F to O) Later in stage 32 (~ 100 dpf), these genes are expressed during patterning of adjacent, parallel rows of body denticle placodes. (P to R and T) ISH section of the body denticles revealed epithelial expression of shh and mesenchymal expression of FGF4, bmp4, and runx2. (S) Expression of FGF3 was observed in the epithelium and mesenchyme. White dashed lines separate columnar cells of the basal epithelium and the underlying mesenchyme. Scale bars, 500 μm (A to E), 2000 μm (F to J), 1000 μm (K to O), and 50 μm (P to T).
Later in developmental stage 32 (~ 100 dpf), body denticle placodes become visible in rows adjacent and parallel to dorsal denticle rows. Body denticles extend throughout the ventral trunk and eventually propagate to the entire flank and ventral surface. We understand that there are multiple initiation sites (48), which are important for the extension of denticle patterning to the extremities, such as the paired pectoral purposes. Redeployment of the same suite of dentine dorsal dentistry (Figure 3, F to O). ISH section revealed that shh was expressed in the denticle epithelium, while FGF4, bmp4, and runx2 were expressed in the underlying mesenchyma (Fig. 3, P to R and T). The expression of FGF3 was noted in both the epithelium and mesenchyma (Fig. 3S). Overall, these results revealed extensive conservation of RD-related gene expression between denticle and feather patterning (18, 43, 49).
RD-related genes are functionally conserved during the patterning of shark body denticles
To verify the functional conservation of the genes during the denticle patterning, we undertook the small-molecule gene pathway inhibition experiments. Embryos were treated with FGF receptor inhibitor SU5402 (50) or dimethyl sulfoxide (DMSO) as a control. Beads were implanted beneath the epithelium in stage 31 embryos (~ 75 dpf), adjacent to rows of dorsal emerging denticle primordia (Fig. 4A). Development then continued before the genetic and phenotypic effects of treatment were examined at various time points.
(AT) Beads loaded with the FGFR inhibitor SU5402 were implanted beneath the epithelium of shark embryos at 75 dpf. (C to NOTFirst, we analyzed gene expression at 5 dpt. We propose that breaking a conserved activator-inhibitor feedback system between FGF4, shh, and bmp4 (B) to localized down-regulation of both shh and bmp4, resulting in stunted growth of dorsal denticle primordia, highlighted by black and white arrowheads (C to J) (17). (K to N) Expression of Spry2, a transcriptional readout of FGF signaling, was also reduced (50). We observed localized inhibition of gene expression at 5 dpt in SU5402 beaded samples (not = 5/5) and no DMSO control samples (not = 5/5). (O) Expression of FGF4 has been shown that this inhibition resulted in a dorsal tooth dentine row, which has become occupied by smaller denticles (not = 2/2). (PNo gap was observed in DMSO control samples (not = 2/2). Alizarin red staining revealed that this gap was maintained in 75% of SU5402-treated dorsal rows at 50 dpt (not DMSO control bead (= 6/8)not = 7/7) (Fig S5). (QThis pattern was maintained in SU5402 beaded dorsal rows at 75 dpt, body denticles had begun to mineralize (not = 7/8). (R) DMSO control samples did not show a gap (not = 9/9). The output of RD simulationS) was consistent with the experimental patterning observed; smaller units in the row (T and U). Dashed black lines show the location of vibratome sections from whole-mount ISH (E, F, I, J, M, and N). Scale bars, 200 μm (C, D, G, H, K, and L), 50 μm (E, F, I, J, M, and N), 300 μm (O and P), and 400 μm (Q and R).
(AT) Beads loaded with the FGFR inhibitor SU5402 were implanted beneath the epithelium of shark embryos at 75 dpf. (C to NOTFirst, we analyzed gene expression at 5 dpt. We propose that breaking a conserved activator-inhibitor feedback system between FGF4, shh, and bmp4 (B) to localized down-regulation of both shh and bmp4, resulting in stunted growth of dorsal denticle primordia, highlighted by black and white arrowheads (C to J) (17). (K to N) Expression of Spry2, a transcriptional readout of FGF signaling, was also reduced (50). We observed localized inhibition of gene expression at 5 dpt in SU5402 beaded samples (not = 5/5) and no DMSO control samples (not = 5/5). (O) Expression of FGF4 has been shown that this inhibition resulted in a dorsal tooth dentine row, which has become occupied by smaller denticles (not = 2/2). (PNo gap was observed in DMSO control samples (not = 2/2). Alizarin red staining revealed that this gap was maintained in 75% of SU5402-treated dorsal rows at 50 dpt (not DMSO control bead (= 6/8)not = 7/7) (Fig S5). (QThis pattern was maintained in SU5402 beaded dorsal rows at 75 dpt, body denticles had begun to mineralize (not = 7/8). (R) DMSO control samples did not show a gap (not = 9/9). The output of RD simulationS) was consistent with the experimental patterning observed; smaller units in the row (T and U). Dashed black lines show the location of vibratome sections from whole-mount ISH (E, F, I, J, M, and N). Scale bars, 200 μm (C, D, G, H, K, and L), 50 μm (E, F, I, J, M, and N), 300 μm (O and P), and 400 μm (Q and R).
First, ISH for RD-related genes was undertaken 5 days posttreatment (dpt). Localized inhibition of shh and bmp4 The present invention has been observed in dorsal dentine placodes treated with SU5402 beads, where DMSO beads (Fig. 4, C to J, and Figs., S3 and S4, A to D) are used. We propose that inhibition of FGF signaling disrupted a conserved activator-inhibitor feedback system between fgf4, shh, and bmp4, which similarly mediates feather patterning (Fig. 4B) (18). Furthermore, we observed down-regulation of sprouty 2 (Spry2) expression (Figure 4, K to N). ace Spry2 is a downstream transcriptional readout of FGF signaling (51This supports the idea that SU5402 treatment leads to FGF inhibition in this system. Sections of whole-mount ISH samples revealed stunted development of denticle primordia (Fig. 4, C to N, and Fig. S4), suggesting that inhibition of FGF signaling during early morphogenesis is sufficient to restrict dorsal denticle growth. As dorsal denticles develop in anterior to posterior gradient, the treatment effect was strongest in the undergoing early morphogenesis at the time of beading, rather than merely the units closest to the bead (Fig. 4, C to N). For example, in Fig. 4K, the bead of the anterior to units with reduced gene expression, as the units closest to the bead are more advanced in their development. Posterior units undergoing early morphogenesis (demarked with a black arrowhead) were affected by the treatment. Growth of the embryo may also affect proximity to the area of inhibition. These results suggest that there is a significant role in the management of shark denticle patterning, with FGF signaling playing an important activatory role.
Next, we examined the effect of the bead implants at 25 dpt, the stage at which smaller body dentures (~ 100 dpf). Using ISH, we visualized FGF4 expression to examine how the disruption of dental dorsal denture subsequent patterning (Fig. 4, O and P, and Fig. S4, E and F). Dorsal denticle primordia failed to undergo morphogenesis following FGF inhibition, resulting in a gap in the row. This gap has become infilled by smaller denticidal denticles (Fig. 4O), which may be used as an adjunct to dorsal denticles. In contrast, control samples displayed in a complete row of dorsal denticles (Fig. 4P). Alizarin red staining of SU5402 beaded samples fixed at 50 and 75 dpt revealed that this pattern was maintained throughout, with smaller, mineralized body denticles occupying the gaps in the dorsal denticle rows (Fig. 4, Q and R, and Figs. S6). Next, we look at this pattern of response with an RD system. Therefore, we simulated the RD model (Fig. 1, K to M) with a unit missing from the initiator row (Fig. 4S) to mimic the functional experiment. The model output boron similarity to the pattern following bead implantation, with smaller units occupying the gap resulting from the star initiator (Fig. 4, T and U). These results provide further evidence that Turing-like systems controls shark dentition patterning, as the model response remains robust following experimental manipulation.
Retuning the RD model can explain the diversity of denticle patterning
Having found evidence for Turing-like denticle patterning in the catshark, we sought to examine the role of this system in other elasmobranch species. Among elasmobranchs, denticles of different densities, with most dense sharks. Comparatively, the dentition coverage of the thornback skate (Raja clavata) and the little skate (Leucoraja erinacea) is enhanced (Fig. 5, A to F). This article presents the results of this study of inhibitors of morphogenesis in the RD model to predict this diversity in elasmobranch denticle density.
(AT to F) Dentistry diversity varies between elasmobranchs, with patterning becoming decreasingly dense from the catshark (S. canicula) to the thornback skate (R. clavata) and the little skate (L. erinacea). (G) Parameters of the RD model were initially set to result in catshark-like patterning. (H) Decreasing the inhibitor's constitutive degradation rate (dv) and maximum net production rate (Gmax) while increasing its diffusion coefficient (Dv) resulted in a less dense thornback skate-like pattern. (E) Initiator spots were made larger and more room to reflect the skate's dorsal row. (I) Decreasing the activator's constitutive production rate (cufurther reduced coverage density, resulting in a little skate-like pattern. S1 for specific parameter values. Scale bars, 400 μm (D) and 1000 μm (E).
"data-icon-position =" "data-hide-link-title =" 0 ">
(AT to F) Dentistry diversity varies between elasmobranchs, with patterning becoming decreasingly dense from the catshark (S. canicula) to the thornback skate (R. clavata) and the little skate (L. erinacea). (G) Parameters of the RD model were initially set to result in catshark-like patterning. (H) Decreasing the inhibitor's constitutive degradation rate (dv) and maximum net production rate (Gmax) while increasing its diffusion coefficient (Dv) resulted in a less dense thornback skate-like pattern. (E) Initiator spots were made larger and more room to reflect the skate's dorsal row. (I) Decreasing the activator's constitutive production rate (cufurther reduced coverage density, resulting in a little skate-like pattern. S1 for specific parameter values. Scale bars, 400 μm (D) and 1000 μm (E).
Model parameters were initially set to result in a catshark-like denticle pattern (Figs 1, K to M, and 5, D and G). The inhibitor's constitutive degradation rate (dv) and maximum net production rate (Gmax) were then decreased, while its diffusion coefficient (Dv) was increased (table S1). Initiator spots were enlarged and spaced further apart to reflect the dorsal row of the skate (Fig. 5E). This model is comparable to the thornback skate (Fig. 5, E and H). Next, the activator's constitutive production ratecu) was decreased (table S1). This further reduces the density of coverage, giving rise to similar patterning to the little skate (Fig. 5, F to I). It is worth noting that there are many alternative methods of measurement (Figure 5, G to I), which are more importantly9). Overall, these results demonstrate that simple alterations to the parameters of the RD model can give rise to a wide diversity of patterns of outcomes comparable to those seen in extant elasmobranch species. The plasticity of this system can be seen in the vast spectrum of vertebrate epithelial appendage patterns.
DISCUSSION
Turing-like system is a well-known and widely used method of cheating18). This mechanism has probably controlled epithelial appendage development for at least 450 million years, spanning the evolution of vertebrates, from sharks to mammals (9, 21, 28). This system includes a dorsolateral initiator that triggers the emergence of environment-controlled appendages, controlled by functionally conserved activators and inhibitors, FGF4, shh, and bmp4 (18). In addition, we suggest that the alteration of the parameters of this system can be explained.
Previous experimental work investigating RD has been widely distributed over its role in amniotes, specifically mice and chicks (18, 21). In addition, the rearrangement of zebrafish pigmentation following partial stripe ablation is concurrent with an RD system (52). Denticle patterning following boread implantation noticeable similarity to this experiment (Fig. 4); in both systems, the gap in the original row was occupied by infilling from adjacent rows. We provide evidence for Turing-like patterning in chondrichthyans. This supports both experimental and theoretical work, suggesting that Turing patterning is of widespread importance throughout vertebrate evolutionary history and is common to taxonomically diverse vertebrate groups (9).
Furthermore, we demonstrate that alterations to the parameters of this system can explain the diversity of epithelial appendage patterns between different species (Fig. 5). Within elasmobranchs, this may have facilitated the evolution of various species-specific denticle functions, including protective armor, hydrodynamic drag reduction, feeding, and communication (5, 7, 29, 33, 53). More broadly, this system may underlie epithelial appendage patterns throughout other vertebrates. For example, RD may control mammalian hair density, which is closely linked to thermoregulation (6). Small changes to this conserved system may underpin pattern diversity throughout vertebrates.
Future research should address the formation of the initiator rows that trigger subsequent Turing patterning (Fig. 2). In the chick, this row originates as a continuous stripe, which then bifurcates into two rows, before the expression becomes localized to individual feather placodes (54). The shark has two initiator rows of denticle placodes (18, 39), suggesting the single bifurcating initiator row of the chick may be a derived feature. Transcriptome sequencing has shown that genes associated with neural development are significantly up-regulated in the skin during patterning of the chick initiator row. This is indicative of developmental synchronicity between the nervous system and feather patterning (55). The shark lateral line is a system of innervated sensory organs that appear parallel to subsequent dorsal row placodes (Fig. 2, A and B, and fig. S2D). It is possible that these systems are synchronous in the shark, with the lateral line mediating the patterning of the shark denticle initiator row. Furthermore, the lateral line extends the entire length of the body and may mediate Turing-like patterning posterior to the dorsal rows, which extend approximately half way along the dorsal trunk. In addition, there are multiple sites of pattern initiation, including those located on the wings and pectoral fins of the chick and elasmobranchs, respectively (48, 56). Whether these sites have individual initiator rows is unknown, presenting a gap in our understanding of pattern initiation.
The importance of RD-controlled patterning has long been debated (9). However, there is a growing body of both theoretical and experimental work supporting the relevance of this model (11, 12, 18–21). Our findings provide support for this research, demonstrating that an ancient Turing-like system controls epithelial appendage patterning in chondrichthyans, which belong to an early diverging lineage, with respect to tetrapods. We suggest that diverse vertebrate groups share this common, conserved patterning mechanism, before deviation in later morphogenesis gives rise to clade-specific integumentary appendages, such as denticles, feathers, and hair.
MATERIALS AND METHODS
Shark and chick husbandry
The University of Sheffield is a licensed establishment under the Animals (Scientific Procedures) Act 1986. All animals were culled by approved methods cited under Schedule 1 to the Act. Fertilized Bovan brown chicken eggs (Henry Stewart & Co., Norfolk, UK) were incubated at 37.5°C before overnight fixation in Carnoy’s solution between E6 and E9. S. canicula embryos (North Wales Biologicals, Bangor, UK) were raised in oxygenated artificial saltwater (Instant Ocean) at 16°C. Shark embryos were culled with MS-222 (tricaine) at 300 mg/liter and fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (PBS). After fixation, chicken and shark embryos were dehydrated through a graded series of PBS to ethanol (EtOH) and stored at −20°C.
Micro-CT and SEM
High-resolution micro-CT scanning was conducted using an Xradia Micro-XCT scanner at the Imaging and Analysis Centre, Natural History Museum, London. S. canicula embryos were stained with 0.1% phosphotungstic acid in 70% EtOH for 3 days to enhance contrast. Scans were rendered using the three-dimensional volume exploration tool Drishti (https://github.com/nci/drishti). SEM was undertaken using a Hitachi TM3030Plus Benchtop SEM scanner at 15,000 V.
Alizarin red clear and staining
Embryos were rehydrated from EtOH to PBS and stained overnight with alizarin red in potassium hydroxide (KOH), as previously described (4). Samples were imaged in glycerol using a Nikon SMZ15000 stereomicroscope. Scale bars were created in Fiji (57).
RD modeling
RD modeling of shark body denticle patterning was undertaken using an activator-inhibitor model proposed by Kondo and Miura (9) based on the equations(1)
(2)where u(t, x, there) and v(t, x, there) denote the concentrations of an activator and inhibitor, respectively, at time t and location (x, there). Equations 1 and 2 describe the rate of change of these concentrations in time and space due to diffusion and regulated production and degradation of the molecular species. The nonlinear functions F(u, v) and G(u, v) are defined by
(3)
(4)
Equations 1 and 2 were solved in the two-dimensional square domain 0 < x < The, 0 < there < The for times 0 < t < T subject to no-flux boundary conditions and prescribed initial conditions that varied across simulations. For the simulations shown in Figs. 1 (K to M) and 5 (G to I), the initial condition was given by(5)
(6)where each (xi, therei) defines the center of a spot in an initiator row representing dorsal denticles of a given number (notspot) and radius (Rspot). Figures 1 (K to M) and 5G were generated using Rspot = 4.5, notspot = 6, and (xi, therei) = (iL/5, The/2). Figure 4 (S to U) was generated using the same initial condition but with the spot centered at (x2, there2) removed. Figure 5H was generated using Rspot = 5.25, notspot = 3, and (xi, therei) = ((3i + 2)The/10, The/2), reflecting fewer, larger, more widely spaced initiator spots.
The RD model was solved numerically using an explicit finite difference method, choosing a spatial discretization Δx and sufficiently small time step Δt to ensure numerical stability. Python code to generate Figs. 1 (K to M), 4 (S to U), and 5 (G to I) is provided in the Supplementary Materials. The parameter values used to generate Figs. 1 (K to M) and 4 (S to U) were given by du = 0.03, Du = 0.02, atu = 0.08, bu = − 0.08, cu = 0.04, Fmax = 0.2, dv = 0.08, Dv = 0.6, atv = 0.16, bv = 0, cv = − 0.05, and Gmax = 0.5, with a domain of size The = 75, end time T = 1500, spot radius R = 4.5, initial concentration u0 = 5, and discretization Δx = The/128 ≈ 0.58, Δt = (Δx)2/8Dv ≈ 0.07. These values were chosen on the basis of an ad hoc exploration of parameter space around parameter values previously identified by Kondo and Miura as leading to patterning (9). Parameter values for Fig. 5 are given in table S1. For Fig. 5 (H and I), because the value of Dv was reduced, we updated the value of Δt = (Δx)2/8Dv ≈ 0.04 to maintain numerical stability.
In situ hybridization
Digoxigenin-labeled antisense riboprobes were designed using partial skate (L. erinacea) and catshark (S. canicula) EST (expressed sequence tag) assemblies (SkateBase; skatebase.org) (58), the Vertebrate TimeCapsule (VTcap; transcriptome.cdb.riken.go.jp/vtcap), and transcriptome data from RNA sequencing (unpublished). Sequences of forward and reverse primers (Sigma) are as follows: chick β-cat, TCTCACATCACCGTGAAGGC (forward) and CCTGATGTCTGCTGGTGAGG (reverse); shark β-cat, GGTGAAAATGCTTGGGTCT (forward) and GGACAAGGGTTCCTAGAAGA (reverse); shark fgf4, ATGTTGATCAGGAAGCTGCG (forward) and GTATGCGTTGGATTCGTAGGC (reverse); shark shh, TGACTCCCAATTACAACCCGG (forward) and TCAGGTCCTTCACTGACTTGC (reverse); shark bmp4, GATCTCTACAGGCTGCAGTCC (forward) and GATCTCTACAGGCTGCAGTCC (reverse); shark fgf3, CTTGCTCAACAGTCTTAAGTTATGG (forward) and CGGAGGAGGCTCTACTGTG (reverse); shark runx2, ATCTCTCAATCCTGCACCAGC (forward) and CCAGACAGACTCATCAATCCTCC (reverse); and shark spry2, AACTAGCACTGTGAGTAGCGG (forward) and GTTCCGAGGAGGTAAACTGGG (reverse). Riboprobes were synthesized using the Riboprobe System SP6/T7 Kit (Promega) and DIG RNA Labeling Mix (Roche). Whole-mount and section ISH was performed as previously described (4, 59). To compare sequences between the chick and shark, phylogenetic gene trees were reconstructed from protein coding sequences extracted from www.ensemble.org, aligned to S. canicula sequences obtained during probe synthesis (see fig. S1 for details) (60, 61). Whole-mount ISH samples were imaged using a Nikon SMZ15000 stereomicroscope, and sections were imaged using an Olympus BX51 microscope and Olympus DP71 Universal digital camera attachment. Vibratome sections shown in Fig. 4 were cut at a thickness of 30 μm. Adjustments to image contrast and brightness were made to improve clarity. Scale bars were added using Fiji (57).
Bead implantation experiments
Embryos were treated with Affi-Gel Blue beads (Bio-Rad) loaded with SU5402 (2 mg/ml; Sigma) in DMSO. Control beads were loaded with DMSO. Stage 31 (~75 dpf) embryos were removed from their egg cases and anaesthetized before beads were surgically implanted using sharpened tungsten wire. Embryos were then cultured in six-well plates with artificial salt water and 1% penicillin-streptomycin (Thermo Fisher Scientific). At stage 32 (~100 dpf), embryos were transferred to 70-ml plastic containers (Sarstedt) floating in a 200-liter tank. The number of replicates and observed effects for different analyses are shown in Table 1.
SUPPLEMENTARY MATERIALS
Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/4/11/eaau5484/DC1
Fig. S1. Phylogenetic gene trees reconstructed from protein coding sequences extracted from www.ensembl.org.
Fig. S2. Dorsal denticle placodes are not visible at stage 31 (~70 dpf).
Fig. S3. Individual vibratome section images comprising false-colored ISH composite images.
Fig. S4. Replicates of beaded shark embryos after whole-mount ISH.
Fig. S5. Replicates of clear and stained shark embryos showing RD response to SU5402 beading.
Fig. S6. SEM images of shark embryo 75 days after beading.
Table S1. Activator and inhibitor values for RD model.
Python script for RD simulations
This is an open-access article distributed under the terms of the Creative Commons Attribution license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
- Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works. Distributed under a Creative Commons Attribution License 4.0 (CC BY).
Source link