Manganese promotes aggregation and exosomal cell-to-exosomal cell transmission of α-synuclein

mn²⁺ exposure upregulates the secretion of oligomeric αSyn in exosomes

New evidence indicates that a misfolded Syyn is a transmissible disease agent responsible for triggering and spreading Parkinson's pathology (25–27). To study the effect of exposure to neurotoxic metal Mn²⁺ on αSyn transmission and the underlying molecular mechanisms, we established a model of dopaminergic neuronal cells expressing αSyn (GFP_Syn) by stably transfecting MN9D mouse dopaminergic neuronal cells with a construct encoding the human-labeled wild type. GFP (NFP) protein, WT) αSyn. A control cell line (GFP_EV) was also generated by stably transfecting cells with a pmaxFP-Green-N control vector. Immunocytochemical analyzes indicated that> 90% of GFP_Syn cells were positive for GFP-labeled human αSyn and that all GFP_EV cells were positive for GFP (Fig. 1A). Western blots indicated a low abundance of endogenous αSyn in both stable cell lines and greater abundance of GFP-labeled GFP-labeled αSyn cells (Fig. 1B).

We then performed 3- (4,5-dimethylthiazolyl-2-yl) -2,5-diphenyltetrazolium bromide (MTT) cytotoxicity assays to determine the susceptibility of naive MN9D cells to Mn.²⁺. The Mn²⁺ concentration required to kill 50% of MN9D cells (LC₅₀in 24 hours was 1129 μM (Fig. S1A). On the basis of this LC₅₀ and previously published doses for Mn²⁺ in dopaminergic neuronal cell lines (28, 29), we chose to use a low dose Mn (300 μM)²⁺ for our further studies. To evaluate whether the cells released from αSyn, we analyzed the amount of αSyn secreted in conditioned medium after Mn.²⁺ treatment in DMUL modified Eagle's medium (Dulbecco). Media was collected and concentrated using centrifugal concentrators with bovine serum albumin (BSA, final concentration, 10 μg / ml) as an internal enriched control. mn²⁺ treatment at 300 μM markedly increased the release of αSyn labeled GFP in the extracellular medium over time-matched untreated cells (Fig 1C and Fig S1B). We also immunoblot the same membranes with an antibody against lactate dehydrogenase A (LDHA), an enzymatic marker indicative of cell toxicity (Fig. 1C and Fig. S1C). Cytotoxicity after exposure to 300 μM Mn²⁺ was minimal in the GFP_Syn and GFP_EV cell groups, further confirming that the αSyn protein detected in the culture medium resulted from the actual release of αSyn and was not due to cytotoxicity.

To further investigate the underlying molecular mechanisms of secretion of αSyn and its importance in the progression of neurodegenerative disorders, we have also characterized the morphological characteristics of the cargo at the origin of the secretion of 39; αSyn. Our analysis of differentially conditioned media ultracentrifuged across TEM indicated the presence of nanoscale exosomal vesicles morphologically similar to previously reported exosomes (9) in vehicles and in manganese²⁺treated samples (Fig. 1D). Further analysis of cell lysates, conditioned media, and exosomes by Western blot analysis revealed that αSyn was primarily enriched in exosome fractions after²⁺ exposure (Fig. 1E). We also comprehensively evaluated particle size and concentration as well as analysis of purified exosome proteins in order to evaluate the effectiveness and purity of the isolation. Our Western blot analysis of isolated exosomes and whole cell lysates revealed the presence of canonical exosome proteins, such as CD9, Alix, Flotillin-1, the decreased nuclear envelope marker Lamin and the endoplasmic reticulum protein GRP78, demonstrating a pure exosome preparation isolated using an ultrafiltration protocol (Fig. S1D). In addition, using the NanoSight LM10, we visualized, counted and measured the size of exosomes isolated from GFP_Syn cells in the presence and absence of Mn.²⁺. The average diameter of the exosomes isolated from the control cells was comparable to that of Mn²⁺treated exosomes (150.8 ± 7.05 nm to 148.6 ± 12.42 nm, respectively, Fig. 1F), indicating that Mn²⁺ exposure does not affect the size distribution of exosomes. These calculated sizes are consistent with previously published observations (6, 9).

We detected significantly more exosomes in the Mn²⁺treated cells (Fig S1E), indicating that Mn²⁺ exposure significantly improves the release of exosomes. Exosomal surface membrane protein markers Alix and Flotillin-1 were easily detected in all exosome samples (Fig. 1G). We observed more αSyn-GFP proteins in exosomes isolated from Mn²⁺unexposed to untreated cells, as determined by Western blot analysis (Fig. 1G), indicating that Mn²⁺ increases the amount of αSyn in exosomal cargoes. Similar results were obtained by quantitative ELISA (enzyme-linked immunosorbent assay) analysis (Fig. S1F). To make sure that the increased exosome release was not induced by the GFP fluorescence label, we explored the exosome release profile with the help of the GFP fluorescence label. a different protein tag based on an αSyn protein linked to a poly (His) affinity tag. Naïve MN9D cells were transfected with a 6x His-tagged human WT α-Syn carrier plasmid or an empty 6 × His plasmid. As described in the previous experiments, the cells were then treated with Mn²⁺and the exosomes were isolated from the conditioned medium. Using a two-color Western blot analysis, we easily detected the His-labeled αSyn release, as indicated by the colocalization of secondary fluorescence antibodies corresponding to 6 × His (green) and ## EQU1 ## 39; αSyn (red) human (Fig. S1G). In addition, the isolated exosomes had the expected morphology (Fig. S1H), size profiles (Fig. S1I) and concentration (Fig. S1J), which corresponds to our observations of exosomes isolated from Mn. .²⁺GFP_Syn cells processed.

The existence of αSyn oligomers in biological fluids and in exosomal fractions isolated from cells in culture (6, 11) has been well characterized. Therefore, the use of conformation-specific antibodies against the prefibrillary oligomers (30) and specifically prefibrillary αSyn species (Fig. S1K), we investigated whether misfolded αSyn proteins accumulate in Mn exosomes.²⁺stimulated cells. Compared to exosomes isolated from vehicle-treated cells, accumulations of prefibrillary oligomers detected by the A11 antibody increased significantly in Mn.²⁺GFP_Syn exosomes not stimulated but not in Mn²⁺exosomes stimulated by GFP_EV (Fig. 1G, lower panel). Our split blot analysis using a new αSyn antibody against filaments easily detected an increase in αSyn filament level in Mn²⁺unstimulated exosomes isolated from GFP_Syn cells (Fig. 1G, bottom) confirming that the accumulation of oligomeric proteins resulted from²⁺induced by the wrong folding of the αSyn protein. In addition, we measured the abundance of misfolded αSyn oligomers in these exosomes using the highly sensitive αSyn fibril formation test based on thioflavin T (ThT). In this mismatched misplaced protein seeding test, exosomes isolated from Mn²⁺or vehicle-stimulated GFP_Syn and GFP_EV cells, presumably acting as seeds with traces of αSyn fibrils, are added to a recombinant human αSyn substrate and repeatedly shaken. By first optimizing the test using different concentrations of αSyn synthesized as seed, we found that the appearance of amyloid fibrils, which increases the intensity of fluorescence when ThT stands linked to aggregates, is directly correlated with the density of fibril seed aSyn (Fig. S1L). This correlation has already been used to quantify the aggregation kinetics of two major forms of amyloid-β peptides and prion-associated forms associated with transmissible spongiform encephalopathy (TSE).31, 32). Here we found that Mn²⁺Exosomes derived from stimulated GFP_Syn cells (hereinafter referred to as "αSyn exosomes") underwent nucleation-dependent aggregation at a significantly higher rate than vehicle-stimulated αSyn exosomes (Fig. 1H). However, we did not observe a marked increase in ThT reading in exosomes derived from GFP_EV (hereinafter referred to as "GFP exosomes") treated with Mn.²⁺ or a vehicle (Fig. 1H). Collectively, our data suggest that Mn²⁺ exposure increases the number of exosomes containing αSyn released and upregulates the aggregated αSyn protein cargo packaged in these exosomes.

mn²⁺stimulated exosomes promote neuroinflammatory responses

Although exosomes play a major role in many physiological and pathological processes, the mode of cell-exosome interaction and the intracellular trafficking pathway of exosomes in their receptor cells remain unclear. Feng and his colleagues (33) have shown that exosomes are more efficiently absorbed by phagocytic cells than by non-phagocytic cells, suggesting that phagocytic processes facilitate the uptake of exosomes. This is particularly important in microglia, which are the resident macrophages of the CNS and whose phagocytic abilities make it the first and principal means of active immune defense. In addition, aberrant activation of glial cells and associated pro-inflammatory cytokines increases in neurodegenerative diseases (3, 34, 35) and in experimental models of PM (36). Therefore, we exposed primary murine microglia to vehicle or manganese.²⁺exosomes stimulated to study whether Mn²⁺The stimulated exosomes have no role in neuroinflammatory processes.

We added purified exosomes to primary microglia and allowed their cell internalization for 24 hours at 37 ° C. Our immunocytochemical analysis with an anti-ionized calcium binding adapter molecule (IBA-1) and anti-GFP antibody revealed the presence of GFP-positive point structures in microglial cells, indicating effective internalization of exosomes. However, only microglia exposed to Mn²⁺Stimulated αSyn-containing exosomes exhibited pronounced amoeboid morphology resulting from the activation and formation of various surface projections, such as bubbles and filopodia, similar to those of other phagocytic cells (Figure 2A). Expression of IBA-1 and inducible nitric oxide synthase (iNOS), revealed by Western blot analysis, increased significantly in Mn-treated cells²⁺exosomes containing αSyn-induced versus cells receiving vehicle-stimulated αSyn-containing exosomes, further confirming distinct activation of microglia and subsequent nitration-enhancing inflammatory stress (Fig 2, B-D). In support of these observations, the release of pro-inflammatory cytokines, such as tumor necrosis factor α (TNFα), interleukin-12 (IL-12), IL-1β and the IL-6, microglia was significantly increased when exposed to Mn²⁺exosomes containing stimulated αSyn, compared to exosomes containing αSyn stimulated by a vehicle or to GFP control exosomes (Fig. 2, E to H). These data collectively indicate that Mn²⁺The stimulated αSyn-containing exosomes are biologically active and capable of activating microglial cells and inducing the release of proinflammatory cytokines, which may further contribute to the inflammatory process.

Microglia internalizes manganese²⁺αSyn exosomes stimulated by caveolin-1 mediated endocytosis

The endocytic process in mammalian cells involves multiple mechanisms depending on the type of host cell, as well as the type of cargo and its fate. Until now, different modes of endocytosis appear to be responsible for the uptake of exosomes by phagocytic and non-phagocytic cells (33, 37, 38). The classical endocytosis mechanisms previously described include clathrin-dependent endocytosis, macropinocytosis, and clathrin-independent endocytic pathways (such as caveolae-mediated absorption associated with lipid rafts in the body). plasma membrane). However, the mechanisms by which exosomes interact with receptor cells such as microglia and how exosomes are sorted after entry into these cells remain unclear. Therefore, we used a WT mouse microglial cell line (WTMC), whose morphology and expression of surface markers are very similar to those of primary microglia (39), to determine which endocytic pathway microglia uses to absorb exosomes. As an initial pharmacological approach, we treated WTMC with various endocytosis inhibitors, including Dynasore, which binds dynamin to inhibit endocytosis in both caveola and clathrin; (N-ethyl-N-isopropyl) amiloride (EIPA), an inhibitor of macropinocytosis; and chlorpromazine and genistein, which inhibit clathrin- and caveolin-mediated endocytosis, respectively (37, 40).

To better visualize the exosomal vesicles, exosomes derived from the cells were previously labeled with the green fluorescent dye PKH67, which is stably incorporated into the lipid regions of the vesicle membrane, and then incubated with WTMC cells. Confocal microscopy revealed efficient internalisation of the vehicle and Mn²⁺exosomes containing αSyn stimulated by WTMC (Figure S2A). The three-dimensional (3D) surface reconstruction images generated by the Imaris software have revealed the homogenous internalization of exosomes by microglial cells and the activated microglial morphology during Mn internalization.²⁺exosomes stimulated by αSyn stimulated by the vehicle but not stimulated by a vehicle (Fig. S2A). Then, we pretreated WTMC with one of the endocytosis inhibitors, chlorpromazine (5 μM), genistein (50 μM), EIPA (10 μM) or dynasore (50 μM) (40) for 60 min at 37 ° C. Subsequently, Mn²⁺Exosomes containing αSyn, labeled with PKH67 and stimulated, were added and the incubation was continued for 24 hours. Confocal microscopy (Fig. 3A) showed successful inhibition (80-90%) of uptake of exosomes by the dynasore and genistein, whereas EIPA and chlorpromazine were unable to control the exosomes. effectively inhibit (50 to 60%) the absorption of exosomes. Therefore, given its independence from clathrin and its dependence on dynamin during internalisation, the uptake of exosomes in our microglial cell cultures was mainly controlled by a endocytosis dependent on caveolae. In a parallel experiment, we co-treated primary microglial cells with Mn²⁺exosomes stimulated by αSyn and endocytosis inhibitors to further analyze the production of proinflammatory cytokines and nitrites. Similarly, the dynasore and genistein significantly attenuated the production of pro-inflammatory cytokines TNFα, IL-1β and IL-6 in response to Mn²⁺αSyn exosomes stimulated, while chlorpromazine and EIPA only marginally or not at all (Fig. 3, B to D). Dynasore, genistein and EIPA, but not chlorpromazine, significantly reduced nitrite production (Figure 3E). So, these data indicate that the primary uptake of Mn²⁺Exosomes containing microglia-stimulated αSyn implicate a caveola-dependent endocytotic pathway.

Then, using primary murine microglial cultures, we confirmed the predominant role of caveolin-1-mediated endocytosis in microglial uptake of exosomes containing αSyn. For this, we used fluorescently labeled transferrin and cholera toxin subunit B (ctxB), which are widely recognized as exclusively internalized ligands via clathrin mediated endocytosis and caveola mediated endocytosis. , respectively, in several types of cells (40, 41). The primary microglial cells were pretreated with chlorpromazine or genistein as described above for 60 min at 37 ° C. At the end of the incubation, the cells were co-treated for 24 hours at 37 ° C. C with one of two combinations: Alexa Fluor labeled 555 with transferrin and labeled exosomes PKH67 (Fig. S2B) or Alexa Fluor 555 labeled ctxB and PKH67- labeled exosomes (Fig. S2C). Although chlorpromazine treatment significantly inhibited transferrin uptake by Alexa Fluor 555, it moderately inhibited the uptake of either PKH67-labeled exosomes or Alexa Fluor 555-conjugated ctxB (Fig. S2B). Cells treated with genistein exhibited a 90 to 100% inhibition of the absorption of exosomes conjugated to Alex Alexa Fluor 555 ctxB and PKH67 (Figure S2C). Genistein, however, did not inhibit microglial uptake of transferrin. Therefore, our data suggest that caveolin-mediated endocytosis is the primary facilitator of recognition and internalization of neuronal exosomes in a microglial cell model.

To further exclude the possible nonspecific effects of pharmacological / chemical inhibitors, we then used the RNA nuclease-guided genome CRISPR-Cas9 for KD caveolin-1 or clathrin in the WTMC to validate our findings Experimental involving the chemical inhibition of endocytosis. Selective gene silencing of caveolin-1 and clathrin in WTMC was confirmed by Western blotting (Fig. S2D). In the analysis of Luminex magnetic bead cytokines, the release of pro-inflammatory cytokines IL-6, IL-12, TNFα and IL-1β was significantly reduced by exposure of clathrin-KD cells to Mn²⁺stimulated αSyn exosomes in contrast to microglial control cells (Fig. 3, F-I). Further reduction of proinflammatory cytokine release stimulated by αSyn exosomes occurred in caveolin-1-KD cells. On the other hand, we did not observe any modification of the anti-inflammatory cytokine IL-10 (Fig. S2E). Par conséquent, l'internalisation microgliale d'exosomes dérivés de cellules neuronales dopaminergiques exprimant αSyn dépend de multiples mécanismes, notamment l'implication d'une endocytose dépendante de la cavéoline-1.

Mn²⁺exosomes αSyn stimulés induisent la mort des cellules neuronales in vitro

Après avoir établi le rôle de Mn²⁺Exosomes αSyn stimulés dans l’activation des processus neuroinflammatoires dans la microglie, nous avons élargi nos expériences pour évaluer si les exosomes jouent un rôle dans la neurodégénérescence. À cette fin, nous avons établi un système de culture mixte neurone-glie utilisant des cellules microgliales primaires et un modèle neuronal dopaminergique humain différencié appelé cellules de Lund mésencéphalique humain (LUHMES) (fig. S3A). Comme les cellules de LUHMES peuvent être différenciées en neurones de type dopamine postmitotiques morphologiquement et biochimiquement matures, elles sont largement utilisées comme système modèle in vitro pour la neurotoxicité dopaminergique (42). Un système de culture cellulaire Transwell nous a permis d'imiter leur environnement CNS en cultivant des cellules microgliales et neuronales pures séparément mais à proximité immédiate au sein du même milieu de culture partagé. Spécifiquement, des microglies primaires pures ont été cultivées sur des inserts supérieurs poreux, alors que des cellules LUHMES différenciées ont été cultivées sur une lamelle couvre-objet dans le puits inférieur de la chambre (fig. S3A). Ainsi, exposer les cellules microgliales à Mn²⁺Les exosomes αSyn non stimulés nous ont permis d’observer une importante Mn²⁺cytotoxicité ou apoptose induites par les exosomes αSyn stimulés, comme indiqué par l’activité accrue de la caspase-3 dans les cellules LUHMES différenciées (fig. S3B). En revanche, les exosomes GFP ou les exosomes αSyn stimulés par le véhicule n’ont pas augmenté significativement l’activité de la caspase-3, ce qui indique que Mn²⁺la mort cellulaire induite par les exosomes αSyn stimulée résulte des effets combinés d’une inflammation accrue et de protéines oligomères conditionnées dans du Mn²⁺exosomes αSyn stimulés. L'absorption d'exosome s'est facilement produite dans les cellules LUHMES traitées par exosome, comme en témoignent les structures de punctate immunoréactives contre la GFP à l'intérieur des cellules neuronales (fig. S3C). L'immunomarquage des cellules LUHMES avec la β-tubuline de classe II spécifique aux neurones (Tuj1) a confirmé la nature post-mitotique totalement différenciée des cellules LUHMES, comme décrit précédemment (42). Collectivement, nos données indiquent que Mn²⁺Les exosomes αSyn stimulés pourraient initier l'apoptose neuronale par l'activation des processus neuro-inflammatoires dans la microglie.

Détection directe de Mn²⁺induite in vitro et in vivo des oligomères αSyn induite par les cellules

Pour clarifier davantage le rôle de Mn²⁺ dans la transmission cellule à cellule des agrégats αSyn, nous avons adopté un test basé sur la complémentation de fluorescence bimoléculaire (BiFC), qui a été appliqué avec succès pour évaluer l’oligomérisation de protéines, l’interaction protéine-protéine et la transmission de cellule à cellule in vitro et in vitro. modèles in vivo (5, 6, 43). Pour cet essai, le WT αSyn humain est fusionné au fragment N-terminal (V1S) ou C-terminal (SV2) de la protéine Venus, qui est une variante améliorée de la GFP (fig. S4A). Ces deux chimères seules ne sont pas en mesure de compléter la fluorescence de Vénus, ce qui ne se produit que lorsque les parties scindées de Vénus fusionnées avec αSyn sont réunies et liées par covalence. Les constructions V1S et SV2 ont été individuellement transfectées dans des cellules MN9D, qui ont ensuite été cocultées (figure 4A). Fluorescence résultant de la dimérisation ou de l’oligomérisation des protéines de fusion V1S et SV2 (44) pendant le transfert de cellule à cellule de αSyn a été visualisée en utilisant BiFC (Fig. 4, A et B). Le Mn²⁺Le système de co-culture V1S / SV2 traité montre un signal BiFC visuellement plus élevé par rapport à la co-culture V1S / SV2 traitée au véhicule en utilisant une analyse par microscopie confocale (Fig. 4A), indiquant que Mn²⁺ la stimulation améliore la transmission de cellule à cellule de αSyn. Pour mieux comprendre le mécanisme de transport de la transmission αSyn par cargaison, nous avons utilisé des exosomes isolés trouvés dans un milieu conditionné recueilli à partir de cultures transfectées individuellement avec V1S et SV2, ainsi que dans des systèmes de coculture V1S / SV2. L'analyse Western blot d'exosomes purifiés a facilement détecté les fragments de protéines V1S et SV2 immunopositifs aSyn et le marqueur de surface exosomale Alix dans des lysats d'exosomes (Fig. 4C), impliquant les exosomes comme mécanisme de cargaison possible pour la transmission de cellule à cellule de αSyn. De plus, lorsque les constructions BiFC V1S et SV2 ont été individuellement transfectées dans des cellules MN9D, aucune des deux cellules n'a présenté de fluorescence (Fig. 4B, deux panneaux de gauche). Cependant, une fois que les cellules ont été co-transfectées avec V1S et SV2 (deux panels de droite), les interactions αSyn-αSyn (6) a reconstitué la protéine fluorescente de Vénus (Fig. 4B). De plus, la formation de la protéine fluorescente Vénus reconstituée a fortement augmenté chez le Mn²⁺cotransfectées non traitées (Fig. 4B, deux panneaux de droite), confirmant que Mn²⁺ l'exposition améliore l'agrégation d'αSyn.

To study the nature of αSyn species visualized by the BiFC assay, total cell lysates were separated with Western blotting and immunoblotted with an anti-ubiquitin antibody. As expected, cells cotransfected with V1S and SV2 followed by Mn²⁺ treatment accumulated both as high–molecular weight polyubiquitinated proteins, indicating that Mn²⁺ enhanced protein oligomerization when compared with vehicle-treated cells (fig. S4B). Using αSyn and GFP antibodies, we also detected discrete bands corresponding to Venus-link-αSyn (V1S) and αSyn-Venus (SV2) protein expression and their N-terminal Venus fluorescent tag (fig. S4B).

To ensure that αSyn oligomerization and transmission were not driven by the Venus fluorescent moieties, we adopted another protein complementation assay based on a luciferase assay system consisting of the two fusion constructs αSyn-hGLuc1 (S1) and αSyn-hGLuc2 (S2) as described elsewhere (6, 44). While this assay uses the same principle as the BiFC assay, Gaussia princeps luciferase only reconstitutes with S1 and S2 protein interaction, allowing direct monitoring of αSyn-αSyn protein interactions in their normal cellular environment. Cotransfection of S1 and S2 constructs showed about fivefold higher luciferase activity relative to the background signal from cells transfected with either S1 or S2 plasmids alone. Furthermore, exposure of S1 and S2 cotransfected cells to Mn²⁺ significantly increased luciferase activity relative to vehicle-treated S1 and S2 cotransfected cells (fig. S4C). These data are consistent with our fluorescent-based BiFC assay results and support our finding that Mn²⁺ exposure induces misfolded αSyn species.

Last, cells cotransfected with V1S and SV2 and treated with either Mn²⁺ or vehicle for 24 hours were fixed and processed for flow cytometry analysis to further confirm that Mn²⁺ promotes cell-to-cell transmission of oligomeric αSyn. Because the reconstituted Venus fluorescent protein formed in the BiFC experiment matures at 37°C as a strong fluorescent signal, we used fluorescence-activated cell sorting (FACS) to contrast GFP-positive cell populations exposed to Mn²⁺ or vehicle treatments (Fig. 4D). Our FACS analysis shows significantly more GFP-positive cells in Mn²⁺-exposed cells than in the vehicle-treated control group (Fig. 4E). Consistent with our BiFC assay, we did not detect GFP-positive cells when transfected with either V1S or SV2. Thus, using multiple experimental approaches, we demonstrate that Mn²⁺ exposure promotes cell-to-cell transmission of αSyn in our cell culture system.

Once we established the effect of Mn²⁺ on cell-to-cell transmission of oligomeric αSyn cell culture models, we attempted to further confirm our findings using animal models of Mn²⁺ toxicity. We used an in vivo protein complementation approach consisting of co-injecting adeno-associated virus (AAVs) encoding αSyn fused to the N- or C-terminal half of Venus fluorescent protein (43). Thirty days after stereotaxically co-injecting AAV8-V1S and AAV8-SV2 into the SNpc of C57BL/6 mice (fig. S4D), animals were exposed to either vehicle or Mn²⁺ (15 mg/kg per day) via oral gavage once daily for another 30 days (fig. S4D). Two additional control groups were injected with either AAV8-V1S or AAV8-SV2 virus to exclude the possibility of nonspecific fluorescence from one-half of the VenusYFP protein, and another group was injected with AAV8-CBA–VenusYFP as a positive control for the experiment. At 60 days after viral injection, the VenusYFP fluorescence that had colocalized in TH-positive cells was visible in the SNpc of animals injected with AAV8-CBA–VenusYFP, confirming our injection target and the expression of VenusYFP epifluorescence (Fig. 4F).

To determine whether Mn²⁺ exposure promotes αSyn oligomerization and pathogenesis in vivo, we used the Kodak In-Vivo FX Image Station to study VenusYFP expression and localization in vehicle-treated and Mn²⁺-exposed mice. Using MATLAB, we captured and converted whole-brain fluorescent images into heat maps, which were then superimposed on white-light reference images to show anatomical localization of VenusYFP fluorescence (Fig. 4G). Quantification of fluorescent intensities indicates that Mn²⁺ promoted V1S and SV2 protein-protein interactions resulting in αSyn oligomerization, which increased about 350% in Mn²⁺-exposed animals when compared to vehicle-treated animals (Fig. 4H). Control animals injected with either AAV8-V1S or AAV8-SV2 alone did not express any VenusYFP fluorescence on the injected side, demonstrating that the fragmented Venus protein lacks background fluorescence.

Because our in vivo study of αSyn-mediated neurotoxicity targeted the SNpc, we also assessed the locomotor behavioral performance of V1S- and SV2-cotransduced and nontransduced mice exposed to Mn²⁺ via oral gavage. Nontransduced and transduced mice were age-matched littermates, and the Mn²⁺ or vehicle exposures were conducted simultaneously. After the 30-day Mn²⁺ treatment paradigm, we measured locomotor performance using a computerized infrared activity monitoring system (VersaMax, AccuScan), which quantifies animal movement variables based on infrared beam breaks. Representative maps of the locomotor movements of vehicle- and Mn²⁺-treated nontransduced (no injection) and transduced (AAV8-V1S + AAV8-SV2) mice suggest that Mn²⁺ decreased movements in both experimental groups and that viral-transduced mice exhibited greater Mn²⁺-induced movement deficits (Fig. 4I). Mn²⁺ markedly decreased the total number of movements (Fig. 4J), total distance traveled (Fig. 4K), and horizontal activity (Fig. 4L) in transduced mice compared to vehicle-treated animals. Our results suggest that αSyn misfolding mediates neurotoxicity and impairs locomotor behavior and that Mn²⁺ exposure augments behavioral deficits.

Next, we examined nigral dopaminergic neuronal viability after a 30-day Mn²⁺ exposure period in both AAV8-V1S + AAV8-SV2–cotransduced and nontransduced animals. Coronal sections through the SN were immunostained for TH and visualized by DAB (Fig. 4M). Dopaminergic neuronal loss was evaluated using unbiased stereology of TH-immunoreactive neurons on both the ipsilateral and contralateral sides. DAB staining and stereological counting of TH⁺ neurons revealed severe loss of nigral dopaminergic neurons, especially in the SNpc and substantia nigra pars lateralis (SNpl) of Mn²⁺-treated AAV8-V1S + AAV8-SV2–cotransduced animals relative to vehicle controls (Fig. 4N). These observations show that Mn²⁺-induced cell-to-cell transmission of oligomeric αSyn promotes nigral dopaminergic neurodegeneration in vivo. In contrast, Mn²⁺-exposed nontransduced animals showed no significant loss of TH⁺ neurons when compared to their vehicle control animals. Overall, these results, together with the abovementioned whole-brain imaging of the cell-to-cell transmission of αSyn, strongly demonstrate that exposure to the environmental neurotoxicant Mn²⁺ can augment the progression of cell-to-cell transmission of oligomeric αSyn in vivo, resulting in dopaminergic neuronal degeneration.

Mn²⁺ exposure promotes exosome release in αSyn-A53T transgenic animals and correlates with αSyn oligomer transmission in humans

Having shown that exposing virally transduced mice to Mn²⁺ induces cell-to-cell transmission of oligomeric αSyn and dopaminergic neurodegeneration, we then evaluated the effect of Mn²⁺ exposure on serum exosome release in αSyn transgenic and littermate control rats. In this study, we used a newly developed BAC (bacterial artificial chromosome) transgenic rat model of PD expressing the A53T mutation of αSyn, which is known to cause early-onset autosomal dominant PD in humans. The mutant human αSyn transgene protein was expressed at an amount ~42-fold above that of endogenous αSyn in transgenic rats (45). The A53T mutation was not detectable in WT Sprague-Dawley control rats. Both nontransgenic and transgenic rats were treated with Mn²⁺ as described above, and their blood was collected through cardiac puncture at study termination. Serum separation and exosome isolation were carried out as described, and total serum exosome numbers were counted using the NanoSight particle analyzer. Mn²⁺-challenged αSyn-A53T transgenic rats produced significantly higher concentrations of exosomes than did either vehicle-treated transgenic rats (P = 0.0035) or nontransgenic rats (P = 0.0082) (Fig. 5A). Furthermore, Mn²⁺ exposure did not alter exosome size but only increased the number of exosomes released (Fig. 5B). Therefore, exosomes may act not only as a means of cell-to-cell communication during increased intracellular stress conditions but also as a cargo mechanism for secretion and cell-to-cell transmission of harmful or unwanted cellular proteins.

It has been proposed that exogenously added misfolded αSyn serves as nucleation seeds for propagating aggregate-initiated polymerization of αSyn in in vitro and in vivo models of PD (15–17, 46). Because exosomes are well recognized as one of the potential mechanisms mediating cell-to-cell transmission of cytosolic protein aggregates (47), and given the strong interaction between metal exposure and PD (24, 48–50), we undertook an exploratory study of the effects of Mn²⁺ exposure on αSyn transmission in humans. As a group, welders are at risk of prolonged exposures to environmental levels of metals, including Mn²⁺, that can be neurotoxic (21, 29, 51). We compared the exosomal αSyn content in serum from welders exposed to Mn²⁺ fumes (age, 26 to 65 years; mean, 46 ± 11.2 years; n = 8 individuals; serum obtained within 90 days of the study) to that found in serum from healthy controls (age, 28 to 73 years; mean, 49 ± 11.0 years; n = 10 individuals) with no history of welding[seedetailsin([seedetailsin([seedetailsin([seedetailsin(22) for the first description of the subjects, as well as (23)]. Serum exosomes were isolated as described above, and total αSyn concentrations in these exosomes were analyzed using a commercially available, highly sensitive luciferase-based αSyn ELISA kit. Total αSyn cargo in the serum exosomes did not differ (P = 0.2855) between welders and controls (Fig. 5C). We also counted total exosome numbers using NanoSight particle analysis. Contrary to our previous observations with transgenic cells and rats, the exosome counts of welders did not differ significantly from that of controls (Fig. 5D). One possible explanation accounting for this result is that the extent of Mn²⁺ exposure experienced by these welders was not sufficient to alter their serum exosome numbers or total αSyn cargo.

Although the outcome we observed in humans did not directly support changes observed in transgenic cells and rats, widely varying αSyn abundance in peripheral blood and CSF samples has been reported in patients with PD relative to healthy controls (2, 52, 53). In the αSyn model of neuron injury, β-sheet–rich soluble oligomers are considered more toxic than monomers (54, 55). Therefore, we measured the abundance of αSyn oligomers in these human exosomes using the αSyn fibril formation assay. Blank and baseline–corrected average kinetic traces for seeded αSyn fibrillar formation assays revealed a significantly different lag phase between the averaged traces of welder exosome samples and those of control individuals. The lag-phase duration was determined from the point where the ThT fluorescence intensity first reached the amyloid detection threshold (Fig. 5E), defined as 5 SDs of the fluorescence intensity of the first 10 hours for the blank (3.66) sample. SEM lag phase was calculated via bootstrap with replacement protocol in MATLAB. The calculated lag phases for control and welder exosomes were 75.5 and 42.5 hours, respectively. Furthermore, we calculated the final fluorescence intensity to compare two kinetic traces by averaging the raw ThT fluorescence of the last 10 data points of each trace (Fig. 5F). Mean ThT fluorescence intensities for controls and welders differed significantly (P < 0.001), indicating that exosomes isolated from welders have a higher seeding capacity and misfolded αSyn protein content compared to exosomes isolated from healthy controls. This observation was further validated with dot blot analysis with antibody against fibrillar αSyn (Fig. 5, G and H). Together, our data indicate that environmental exposure to neurotoxic metals, such as Mn²⁺, increases the abundance of misfolded protein cargo in circulating exosomes. However, given the limitations associated with sample isolation and collection, it must be noted that blood-derived exosomes are an indirect measure of cell-to-cell transmission in the CNS. As such, it is unclear whether the results shown here are due to exosome clearance from the blood or are exosomes released by affected neurons into the systemic circulation. Nevertheless, previous reports indicate the presence of CNS-derived αSyn in plasma exosomes in patients with PD (56) and increased phosphorylated tau and amyloid-β (Aβ) proteins in blood-derived exosomes in patients with Alzheimer’s disease (57), further suggesting a role of exosomes in disease pathogenesis.

Mn²⁺-stimulated αSyn exosomes induce Parkinson-like motor deficits in mice

The accumulation of misfolded proteins and associated behavioral deficits is fundamental pathogenic process in the progression of PD (46). Furthermore, evidence from recent in vitro and in vivo studies suggests that misfolded proteins play a central role in a variety of neurodegenerative disorders by functioning as “seeds” for progressive protein misfolding and aggregation processes, much like prions (58, 59). Thus far, we have shown that Mn²⁺-stimulated exosomes contain prefibrillar αSyn oligomers that potentiate neuroinflammatory and degenerative responses in vitro. As a next step, we directly investigated whether Mn²⁺-stimulated αSyn exosomes carry disease-associated prefibrillar αSyn oligomers, which can seed and propagate pathology in vivo. We injected C57BL/6 mice with exosomes isolated from Mn²⁺– or vehicle-treated GFP_EV and GFP_Syn cells. About 4 × 10⁸ to 5 × 10⁸ of exosomal particles (total exosome proteins, ~8 μg) from each treatment group were stereotaxically injected into one side of the striatum (Fig. 6A), and neurobehavioral deficits were monitored over time. The behavioral performance of animals injected with αSyn exosomes tended to worsen when tested again at 180 days after inoculation. Specifically, mice receiving Mn²⁺-stimulated αSyn exosomes tended to be more hypoactive, showing reduced exploratory locomotor activity as measured by stereotypy counts (Fig. 6B) in an open-field locomotor test. However, some behavioral deficits, such as movement time (Fig. 6C), were not statistically significant, perhaps because exosome injections were done unilaterally, and the observed αSyn-containing proteinaceous inclusions were primarily localized in cortical-striatal regions proximal to the injection site. PD has long been recognized as an asymmetric disorder, with unilateral motor symptom onset as one of its cardinal features, especially in patients classified as early-stage PD (60–62). The etiology of these asymmetric motor symptoms remains unclear, although several hypotheses involving lateralized vulnerability, an index of abnormal protein deposition, have been advanced (60, 61). To test for a possible behavioral bias arising from exosome-induced behavioral asymmetry, we used the amphetamine-induced rotation test. Our data indicated increased ipsilateral movements in the Mn²⁺-stimulated αSyn exosome–injected mice, thus indicating unilateral CNS damage in these animals, when compared to mice receiving vehicle-stimulated αSyn exosomes or vehicle- and Mn²⁺-stimulated GFP exosomes (Fig. 6D). Although the mechanism for the unilateral behavioral bias encountered here is not completely understood, it likely involves an increase in neurodegenerative processes induced by ipsilaterally localized, αSyn-containing proteinaceous inclusions.

To confirm in vivo αSyn misfolding, we examined whether Mn²⁺-stimulated αSyn exosomes lead to the deposition of αSyn-containing proteinaceous inclusions. Histological analyses revealed Ser¹²⁹-phosphorylated αSyn (pSyn129) and p62-immunoreactive cytoplasmic inclusions in mice injected with Mn²⁺-stimulated αSyn exosomes (Fig. 6E) but not in mice injected with vehicle-stimulated αSyn exosomes or vehicle- and Mn²⁺-stimulated GFP exosomes (fig. S5, A to F). Furthermore, our dual staining with pSyn129 and microglia marker IBA-1 reveals microglial cells with larger cell bodies and shorter processes around the pSyn129-positive neurons, indicating that Mn²⁺-stimulated αSyn exosomes triggered an inflammatory response in the brain. In contrast, animals injected with vehicle-stimulated αSyn exosomes resulted in no pSyn129 pathology in cortical regions (fig. S5A) and minimal pathology around the striatal injection site (fig. S5D). Mice receiving vehicle-stimulated GFP exosomes (fig. S5, B and E) or Mn²⁺-stimulated GFP exosomes (fig. S5, C and F) did not exhibit any protein inclusions or GFP-immunopositive structures, suggesting that the GFP protein may have been cleaved off and degraded. Collectively, our results indicate that Mn²⁺-stimulated, αSyn-containing exosomes can initiate certain Parkinsonian symptoms and propagate αSyn misfolding and aggregation in mice. Collectively, our experimental results have important implications pertaining to the prion-like, cell-to-cell transmission of aggregated proteins in progressive neurodegenerative disorders.

Chemicals and reagents

Advanced DMEM/F-12, DMEM/F-12, Neurobasal medium N2 supplement, B27 supplement, fetal bovine serum (FBS), l-glutamine, Lipofectamine 2000, Alexa fluorophore–tagged secondary antibodies, Hoechst nuclear stain, penicillin, streptomycin, and other cell culture reagents were purchased from Life Technologies (Gaithersburg, MD). Antibodies for rabbit iNOS and Syn211 were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Mouse TH antibody, Alix, A11, IBA-1, GFP, and fibrillar confirmation-specific αSyn antibodies were purchased from Millipore (Temecula, CA). Antibodies for LDHA, clathrin, and caveolin-1 were obtained from Cell Signaling Technology (Danvers, MA). Antibody for phosphorylated (S129) αSyn and IBA-1 (rabbit) was purchased from Wako. Ubiquitin antibody was purchased from Dako (Carpinteria, CA). Mouse β-actin antibody, PKH67, and all other chemicals were obtained from Sigma-Aldrich (St. Louis, MO). Western blot supplies and the Bradford protein assay kit were purchased from Bio-Rad Laboratories (Hercules, CA). To construct the GFP-fused αSyn plasmid (αSyn-pMAXGFP), human WT αSyn complementary DNA was subcloned to pmaxFP-Green-N (Lonza) from the αSYN-pCEP4 (68) plasmid. The mammalian expression plasmid for the N-terminal hemagglutinin-tagged and C-terminal His-tagged WT human αSyn (pHM6-αSyn-WT) was a gift from D. Rubinsztein (Cambridge; Addgene plasmid no. 40824) (79). The bacterial expression plasmid bearing the WT human αSyn (pT7-7 αSyn WT) was a gift from H. Lashuel (Swiss Federal Institute of Technology-Lausanne; Addgene plasmid no. 3604) (80). The αSyn BiFC plasmids, Gaussia luciferase protein fragment complementation assay plasmids [αSyn-hGLuc (1) and αSyn-hGLuc (2)], pAAV8-CBA-Venus1-Synuclein-WPRE (AAV8_V1S), pAAV8-CBA-Synuclein-Venus2-WPRE (AAV8_SV2), and pAAV8-CBA-Venus (AAV8_venusYFP) virus were provided by P. J. McLean (Mayo Clinic, Jacksonville, FL) and generated as described previously (43, 44). Recombinant αSyn monomers and fibrils were gifts from the Michael J. Fox Foundation for Parkinson’s Research.

Cell cultures and stable expression of αSyn

For αSyn release and exosome isolation experiments, we created a GFP-tagged αSyn stably expressing MN9D dopaminergic cell line. Expression plasmids encoding human full-length αSyn-pMAXGFP and control pMAXGFP (Lonza) were transfected into MN9D cells using Lipofectamine 2000 reagent and grown in DMEM (Sigma-Aldrich, catalog no. D5648) supplemented with penicillin (50 IU/ml), streptomycin (50 μg/ml), and 10% FBS. For stable transfection, MN9D cells were selected after culturing in geneticin (400 μg/ml) for 1 week after transfection and then maintained in media supplemented with geneticin (200 μg/ml). GFP-positive αSyn-expressing (GFP_Syn) and vector control (GFP_EV) cells were further selected by the FACSAria III (BD Biosciences) high-speed sorting flow cytometer to obtain homogeneously transgene-expressing cell populations.

Primary murine microglial cells were isolated from mixed cultures prepared from C57BL/6 mouse pups, postnatal days P0 to P1, using a column-free magnetic separation method as previously described (81). Exosome-induced neurodegeneration experiments were carried out with primary mesencephalic cultures and differentiated LUHMES cells. Primary mesencephalic neuronal cultures and LUHMES cells were grown and differentiated as previously described (82–84).

The immortalized WT (C57BL/6) murine microglial cell line (WTMC), with morphology and surface marker expression highly similar to primary murine microglia, was a gift from D. Golenbock (University of Massachusetts Medical School, Worcester, MA) (39). These cells were grown in DMEM medium supplemented with penicillin (50 IU/ml), streptomycin (50 μg/ml), and 10% FBS, with exosome stimulation done in 2% DMEM. The WTMC was used for exosome-induced neuroinflammation experiments and identification of a possible endocytic pathway. KD of caveolin-1 and clathrin was achieved using the CRISPR-Cas9 nuclease RNA-guided genome editing system in primary microglial cells. The lentivirus-based CRISPR-Cas9 plasmids, pLV-U6 g-EPCG-Cav1, and pLV-U6 g-EPCG-Cltc with the caveolin-1 and clathrin guide RNA target sequences GTTGAGATGCTTGGGGTCGCGG and TACTGAAGCCAATGTTTGCTGG, respectively, were purchased from Sigma-Aldrich. To make the lentivirus, the lenti–CRISPR-Cas9 Cav1 and C1tc plasmids and control plasmid were transfected into 293FT cells using the Mission Lentiviral Packaging Mix from Sigma-Aldrich, according to manufacturer’s instructions. The lentivirus was harvested over 72 hours after transfection and added to the microglial cell line to KD caveolin-1 and clathrin expression.

Media protein precipitation for Western blot

After treatment, 2 ml of media was collected, and exosomes were isolated using ExoQuick TC. After exosome isolation, medium was transferred into fresh tubes. An equal amount of methanol was added to the media. After methanol addition, 200 μl of chloroform was added to the mixture and mixed vigorously for 30 s. The samples were spun down at 13,000g for 5 min at 4°C. After three phases appeared, the aqueous part was removed, and protein was kept. The protein was vortexed until white flakes appeared. Mixture was centrifuged at 15,000g for 5 min at 4°C and removed the supernatant after centrifugation. Tubes were dried at 55°C in a thermoshaker at 300g for 5 to 10 min. Pellets were reconstituted in 40 μl of 1× dye.

Immunocytochemistry and immunohistochemistry

For immunocytochemistry, MN9D cells and microglial cells were plated on poly-re-lysine–coated (50 μg/ml) 12-mm glass coverslips, and treatments were done as described. LUHMES cells were plated on coverslips precoated with poly-l-ornithine (50 μg/ml; Sigma-Aldrich) overnight, washed twice with cell culture grade water (Invitrogen), and then incubated with fibronectin (1 μg/ml; Sigma-Aldrich) overnight. After treatments, cells were washed with phosphate-buffered saline (PBS) and incubated in 4% paraformaldehyde for 30 min at room temperature. After fixing, the cells were washed with PBS and incubated in blocking agent (2% BSA, 0.05% Tween 20, and 0.5% Triton X-100 in PBS) for 45 min. Cells were then incubated with antibodies against human αSyn (1:500; Syn211; Santa Cruz Biotechnology), GFP (1:2000; Abcam), and IBA-1 (1:500; Wako) overnight at 4°C or the cytoskeleton marker phalloidin (Alexa Fluor 647 phalloidin; Invitrogen) for 30 min at room temperature. After primary incubation, the cells were washed and incubated in the dark for 90 min with Alexa Fluor 488 and Alexa Fluor 555 dye–conjugated secondary antibodies (1:1000; Invitrogen). Hoechst 44432 was used as a nuclear stain, and the coverslips were then mounted on glass slides and viewed with 63× and 43× oil objectives using a Leica DMIRE2 confocal microscope. Photomicrographs were further processed using Imaris software to analyze the Z-stack images for exosome internalization. Using 3D surface reconstruction, we generated surface topology images using the maximum intensity projection image.

For immunohistochemistry studies, fixed brains embedded in optimal cutting temperature compound were sectioned at 30 μm using a cryostat (CryoStar NX70, Thermo Fisher Scientific) or processed as 7-μm paraffin-embedded sections. Free-floating sections were processed for immunohistochemical analysis as described in our previous publications (85, 86) using antibodies against TH (1:1200; clone LNC1; Millipore). DAB immunostaining was performed on SN sections as described previously (85–87) for stereological counting of TH⁺ neurons. Briefly, 30-μm sections were incubated with anti-TH antibody overnight at 4°C. Then, sections were incubated with biotinylated anti-rabbit secondary antibody (1:300; Vector Labs) for 1 hour at room temperature, followed by incubation with avidin peroxidase (Vectastain ABC Elite kit; Burlingame, CA). Immunolabeling was visualized by exposure to DAB (0.5 mg/ml), nickel ammonium sulfate (2.5 mg/ml), and 0.03% H₂O₂, followed by incubation with hematoxylin nuclear counterstain (Vector Hematoxylin QS, H-3404). Sections were mounted on charged glass slides, dehydrated in xylene, and coverslipped with DPX mounting medium (Sigma-Aldrich, catalog no. 44581). Total numbers of TH-stained neurons in the SN were counted stereologically with Stereo Investigator software (MicroBrightField Inc., Williston, VT) using an optical fractionator. For pS129 αSyn studies, 7-μm-thick paraffin-embedded sections of mouse tissues were deparaffinized and subjected overnight to antigen retrieval using citrate buffer. Sections were then incubated with blocking reagent (10% normal goat serum, 2% BSA, and 0.5% Triton X-100 in PBS) for 60 min before being incubated with a mouse monoclonal antibody against Ser¹²⁹-phosphorylated human αSyn (1:5000; pSyn129/81A). Immunolabeling was visualized with DAB peroxidase (with nickel) or Vector SG (Vector Labs) substrate kits.

Western and slot blotting

Whole-cell lysates or exosome lysates were prepared using modified radioimmunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA), as described previously (68, 88). For αSyn release experiments, GFP_Syn and GFP_EV cells were treated in serum-free medium and spiked with BSA (10 μg/ml), and then, the media was collected and centrifuged for 5 min at 3000g to remove any dislodged cells or cell debris. The conditioned medium was concentrated using 5000 MWCO Vivaspin-20 spin columns (GE Healthcare Life Sciences), and then, protein concentrations were determined with the Bradford protein assay kit. Cell lysates containing equal amounts of protein were separated on a 12 to 15% SDS–polyacrylamide gel electrophoresis. After separation, proteins were electroblotted onto a nitrocellulose membrane, and nonspecific binding sites were blocked by treating with LI-COR blocking buffer. Primary antibodies for Syn-1 (BD Biosciences), Flotillin-1 (BD Biosciences), BSA (Invitrogen), LDHA (Cell Signaling Technology), Aip1/Alix (Millipore), IBA-1 (Wako), iNOS (Santa Cruz), and β-actin (Sigma-Aldrich) were used to blot the membranes.

The formation of oligomeric proteins after Mn²⁺ exposure was analyzed with a slot blot apparatus (Bio-Dot, Bio-Rad) using the antibody against protein oligomers (A11, Invitrogen) and αSyn filament-specific antibody (MJFR-14-6-4-2, Abcam). After protein adsorption, membranes were blocked with 5% BSA and incubated overnight with the A11 antibody or αSyn filament antibody. Membranes then were developed with IR800-conjugated anti-rabbit or Alexa Fluor 680–conjugated anti-mouse secondary antibody for 1 hour at room temperature. Western and slot blot images were captured with the Odyssey IR Imaging system (LI-COR), and data were analyzed using Odyssey 2.0 software.

Exosome isolation

Cell-produced exosomes were isolated using the ExoQuickTC (System Biosciences) exosome precipitation reagent or were purified by differential ultracentrifugation via slight modification of a process described previously (9, 12). Briefly, GFP_Syn and GFP_EV cells at 70 to 80% confluency were treated with or without 300 μM Mn²⁺ in exosome-depleted medium containing 10% FBS for 24 hours. After treatment, cell culture supernatant was collected and spun at 300g for 10 min to remove cells and 10,000g for 15 min to exclude cell debris from the supernatant. The resulting medium was then passed through a 0.2-μm syringe filter (Millipore) to remove any remaining particles or cell debris, and the filtrate was centrifuged at 100,000g for 90 min using a Beckman Optima L-100 XP ultracentrifuge. The pellet containing exosomes was washed once with cold PBS and centrifuged again at 100,000g for 90 min using a Beckman Optima MAX ultracentrifuge. Exosome pellets were either resuspended in 50 μl of RIPA buffer for Western blot analysis or, when treating primary microglial cells, they were resuspended in 150 μl of DMEM-F12. Total serum exosomes from welders and control subjects were isolated using ExoQuick (System Biosciences) reagent following the manufacturer’s recommended protocol.

MTT assays

The MTT assay has been widely used to assess the LC₅₀ and cell viability by measuring the formazan produced when mitochondrial dehydrogenase enzymes cleave the tetrazolium ring (29). In this study, we used the MTT assay to determine the LC₅₀ of Mn²⁺ for MN9D cells. Briefly, 20,000 MN9D cells were seeded on a 96-well microplate, allowed to adhere for 16 hours, and then treated for 24 hours with Mn²⁺ (0 to 10 mM) in serum-free DMEM media. After the treatment, the cells were washed with warm PBS and then incubated with 200 μl of 0.25% (w/v) MTT in serum-free DMEM for 2 hours at 37°C. The supernatant was removed, and MTT crystals were solubilized in 200 μl of dimethyl sulfoxide. Mitochondrial activity was measured with the SpectraMax spectrophotometer (Molecular Devices Corporation) at 570 nm with the reference wavelength at 630 nm.

Nitric oxide and cytokine detection in microglia

Quantification of nitric oxide production by microglial cells after exosome treatment was measured indirectly by quantification of nitrite in the supernatant using the Griess reagent (Sigma-Aldrich). Microglia plated at 70,000 cells per well were either treated for 24 hours with exosomes (1:100) or pretreated with endocytosis inhibitors for 1 hour and cotreated with exosomes for 24 hours. At the end of treatments, equal volumes of cell media and Griess reagent were added to a 96-well plate along with a sodium nitrite standard curve, and absorbance at 540 nm was measured on a SpectraMax microplate reader. The supernatant was used to determine extracellular cytokine levels using the Luminex bead-based immunoassay system and recombinant standards for IL-6, IL-12, IL-10, TNFα, and IL-1β (81).

Nanoparticle tracking analysis

Ultracentrifuged or ExoQuick/TC-precipitated exosome samples were used for nanoparticle tracking analysis (NTA), as previously described (12, 89, 90). Briefly, isolated exosomes were resuspended in 500 to 1000 μl of PBS, from which about 300 μl was loaded into the sample chamber of an LM10 unit (NanoSight, Amesbury, UK) using a disposable syringe. Sample durations of 30 to 60 s per sample were analyzed with NTA 2.3 software (NanoSight). Samples containing higher numbers of exosomes were diluted before the analysis, and their relative concentrations were then calculated according to the dilution factor.

Transmission electron microscopy

Purified exosomes were resuspended in 200 μl of PBS. Next, 20 μl of each sample was mixed with uranyl acetate 2% (w/v) and incubated for 5 min, and then, 5 μl was applied to carbon-coated copper grids. Images were taken using a JEOL 2100 200-kV scanning and transmission electron microscope with a Thermo Fisher Noran System 6 elemental analysis system. TEM was operated at 80 kV, and images were obtained at 18,000× to 20,000× magnification.

Quantification of αSyn in exosomes

Concentrations of αSyn in cell-derived exosomes and human exosomes isolated from serum were determined by using human αSyn ELISA kits [Invitrogen (catalog no. KHB0061) or Covance (catalog no. SIG-38974)], as previously described (91). Briefly, exosomes were isolated using ultracentrifugation or by ExoQuick reagent and lysed using RIPA buffer following manufacturer’s instructions.

αSyn fibril formation assays

For the αSyn amyloid fibrillization assay, purified recombinant nonaggregated human αSyn was used as a substrate, and exosomes isolated from welder and control serum samples were used as a seed. The assay also consisted of blank (PBS) wells as a negative control and exogenously produced recombinant αSyn fibrils as a positive control. Each sample was run in four replicates, and the representative graph shown for welders and controls consists of average fluorescence from all welders and controls with four replicates for each sample. The αSyn fibrillization assay was performed in a 100-μl reaction mixture consisting of 5 μl of 100-fold diluted serum exosomes in 0.05% SDS in PBS, recombinant αSyn (0.2 mg/ml), 300 mM NaCl, 10 μM EDTA, and 20 μM ThT in a BMG CLARIOstar plate reader using Nunc MicroWell 96-well optical-bottom plates. The reaction was carried out at 42°C by alternating shake and rest cycles every other minute with readings taken every 30 min over a 100-hour period.

Animal studies

Male C57BL/6 mice (8 to 12 weeks old) were purchased from Charles River Laboratories and used for all mouse experiments. Human αSyn-A53T–overexpressing BAC transgenic rats (model number 10678) and noncarrier littermate control Sprague-Dawley rats were obtained from Taconic Biosciences (Germantown, NY). Rodents were housed on a 12-hour light cycle with ad libitum access to food and water. Iowa State University’s (ISU) laboratory animal facility is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, and all procedures involving animal handling were approved by the Institutional Animal Care and Use Committee at ISU. For unilateral viral transduction experiments in mice, we injected a total volume of 2 μl of virus at a rate of 0.2 μl/min using a 10-μl Hamilton syringe with a 30-gauge needle, which was guided using the Angle 2 stereotaxic apparatus (Leica Biosystems, St. Louis, MO) to target the SN with the use of the following coordinates (millimeters from the bregma): anterior posterior (AP) (−3.30), medial lateral (ML) (−1.20), and dorsal ventral (DV) (−4.60). For cotransduction of AAV8_V1S and AAV8_SV2 viruses, 1 μl of pAAV8-CBA-Venus1-Synuclein-WPRE (AAV8_V1S) virus (titer 8.3 × 10¹² viral genome/ml) and 1 μl of pAAV8-CBA-Synuclein-Venus2-WPRE (AAV8_SV2) virus (titer 8.7 × 10¹² viral genome/ml) were injected. For the VenusYFP transduction group, 2 μl of pAAV8-CBA-Venus virus (titer, 1 × 10¹² viral genome/ml) was injected. Four weeks after injection, the AAV8_V1S/AAV8_SV2 cotransduction group received either Mn²⁺ (15 mg/kg body weight per day; as MnCl₂) for 30 days or an equal volume of vehicle (water) via oral gavage to assess the impact of environmental Mn²⁺ exposure on the cell-to-cell transmission of αSyn. To control for the unintended effect of stereotaxic injections on animals, we also included a group of animals receiving Mn²⁺ (15 mg/kg) or an equal volume of vehicle, similar to the AAV cotransduction group, but without stereotaxic injection. To evaluate the effect of Mn²⁺ on serum exosome numbers, human αSyn-A53T–overexpressing and nontransgenic rats were exposed to a similar Mn²⁺ treatment paradigm as described for mice. This Mn²⁺ dose regimen was chosen on the basis of previous studies in humans and animals (69–71).

For stereotaxic delivery of exosomes to the striatum, we injected a total volume of 3 μl of exosomes (3.6 × 10⁸ particle numbers) isolated from Mn²⁺– or vehicle-stimulated GFP_Syn and GFP_EV cells. Twelve weeks after injection, animals were subjected to a battery of behavior tests, including an open-field test and the amphetamine-induced rotational test. Mice then were euthanized, and their tissues were collected for biochemical and neurochemical analyses, or they were transcardially perfused for histological procedures.

Behavioral measurements

Exploratory locomotor activity was measured using the VersaMax open-field apparatus (AccuScan Instruments, Columbus, OH) as described previously (87), and the following indices were monitored for 10 min: rearing activity (labeled as vertical activity), horizontal activity, total distance traveled, stereotypy count, and total movement time. The rotameter test was used to assess the effects of unilateral exosome injection-induced lesions. At 160 days after exosome injection, mice received amphetamine[[[[re-amphetamine sulfate (5 mg/kg), Sigma-Aldrich]intraperitoneally. Then, after 20 min, each mouse was placed in a cylindrical bowl within which amphetamine-induced ipsilateral rotation was recorded via a video camera coupled to automated tracking software (ANY-maze, Stoelting). Rotational scores were used as an estimate of the extent of lesions with data expressed as the average numbers of ipsilateral rotations per 20-min period.

Human studies

Sixty-six subjects were recruited initially from meetings of regional unions in Philadelphia and Harrisburg, Pennsylvania, and from the community around the Penn State Milton S. Hershey Medical Center. Welders (45.8 ± 11.2 years old) were defined as subjects with recent exposure (within 90 days) and controls as those without a history of welding. All subjects were male, answered negatively for past Parkinson’s diagnosis or other neurological disorders, and were free of any obvious neurological or movement deficits using the Unified Parkinson’s Disease Rating Scale III with a threshold score of <15 (24). For detailed demographic information, including exposure metrics, blood metal levels, and magnetic resonance imaging measures (R1 regional values and pallidal index) in welder and control cohorts, please refer to our previous publications (92, 93). Written informed consent was obtained in accordance with guidelines approved by the Penn State Hershey Internal Review Board. Welders represented several trades and industry groups (such as boilermakers, pipefitters, railroad welders, and various manufacturing jobs). Controls were age-matched volunteers from the same regional community with various occupations. Whole-blood samples were obtained by venipuncture. Samples rested at room temperature for ~15 min, after which they were centrifuged. The serum supernatant was pipetted in 1-ml aliquots into 2.5-ml cryovials and stored at −80°C. Before sending samples to ISU, samples were blinded, and 200 μl of serum was shipped overnight. This serum was used to isolate exosomes as described above and was analyzed for exosome numbers, total αSyn concentration using ELISA, and misfolded αSyn content using αSyn amyloid fibrillization assay. These “blinded” samples were analyzed, and exosome numbers were reported back to Penn State for unblinding and further analysis.

Statistical analysis

Data analysis was performed using GraphPad Prism 7.0 software. Normally distributed raw data were analyzed with either Student’s t test or using one-way ANOVA, and then, Tukey’s posttest was performed to compare all treatment groups. Raw data from non-Gaussian distributions were analyzed with Kruskal-Wallis test, followed by Dunn’s multiple comparisons test to compare all treatment groups. Experiments compared the mean differences between all groups using three-way ANOVA, followed by Tukey-Kramer multiple comparisons using statistical analysis system (SAS). Statistically significant differences were denoted as *P ≤ 0.05, **P < 0.01, and ***P < 0.001.